Clone

Target
IDP02637  
Clone Suffix
201
Experiment Start Date
Mar 15, 2011  
Experiment End Date
 
Person
Veronica Yim  
Lab
University of Calgary  
Protocol ID
20  
Status
success  
Vector
pET21b-L No TEV  
Sequence Start
1  
Sequence End
66  
Reference Sequence Used
MKHVKSVFLA MVLILPSSLY PALTIAADSQ DHKKEETIKP MPQKWCNLWP AGIPFPEDWF KMCRGY  
PCR Forward Primer
GGAGATATACATATGAAACACGTCAAGAGCGTATTTTTAG  
PCR Backward Primer
GTGGTGGTGCTCGAGATAACCTCTACACATTTTAAACC