Clone

Target
IDP00083  
Clone Suffix
126
Sequence Comments
IDP00083.1-380.F..pMCSG28  
Experiment Start Date
Jan 10, 2008  
Experiment End Date
Jan 10, 2008  
Person
Minyi Gu  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
success  
Vector
pMCSG28  
Sequence Start
1  
Sequence End
380  
Reference Sequence Used
MDFNLNDEQE LFVAGIRELM ASENWEAYFA ECDRDSVYPE RFVKALADMG IDSLLIPEEH GGLEAGFVTV AAVWMELGRL GAPTYVLYQL PGGFNTFLRE GTQEQIDKIM AFRGTGKQMW NSAITEPGAG SDVGSLKTTY TRKNGKVYLN GSKCFITSSA YTPYIVVMAR DGASPDKPVY TEWFVDMSKA GIKVNKLEKL GLRMDSCCEI TFDDVELDEK DMFGREGNGF NRVKEEFDHE RFLVALTNYG TAMCAFEDAA RYANQRVQFG EAIGRFQLIQ EKFAHMAIKL NSMKNMLLEA AWKADNGTIT SGDAAMCKYF CANAAFEVVD TAMQVLGGVG IAGNHRITRF WRDLRVDRVS GGSDEMQILT LGRAVLKQYR  
PCR Forward Primer
GTCTCTCCCATGGATTTCAACTTAAATGACGAACAGGAG  
PCR Backward Primer
GGTTCTCCCCAGCGCGGTATTGCTTAAGTACCGCAC  
Shipped To Lab
ANL  
Shipped Date
Jan 10, 2008  
Inserted
Jul 29, 2011