Clone

Target
IDP01014  
Clone Suffix
265
Experiment Start Date
Mar 17, 2010  
Experiment End Date
 
Person
Rosa Di  
Lab
University of Calgary  
Protocol ID
Cloning_protocol_Toronto  
Status
success  
Vector
p15Tv lic  
Sequence Start
17  
Sequence End
161  
Reference Sequence Used
GAGTSAAMRQ ATSPKTILEY IINFFTCGGI RRRNETQYQE LIETMAETLK STMPDRGAPL PENIILDDMD GCRVEFNLPG ENNEAGQVIV RVSKGDHSET REIPLASFEK ICRALLFRCE FSLPQDSVIL TAQGGMNLKG AVLTG  
PCR Forward Primer
TTGTATTTCCAGGGCGGCGCGGGGACTTCTGC  
PCR Backward Primer
CAAGCTTCGTCATCATCCGGTAAGGACAGCGCC