Clone

Target
CPX_00403_00493  
Clone Suffix
102
Sequence Comments
CPX_00403_00493.23-430.P(430)..pMCSG68  
Experiment Start Date
Apr 02, 2013  
Experiment End Date
Apr 02, 2013  
Person
Jerzy Osipiuk  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
success  
Vector
pMCSG68  
Sequence Start
 
Sequence End
 
Reference Sequence Used
 
PCR Forward Primer
TACTTCCAATCCAATGCCGTTCGGATTGAGATTACCCAAGGG  
PCR Backward Primer
TTATCCACTTCCAATGTTAGTAAACCAGAACTGCACGACGGTTTTTA  
Shipped To Lab
ANL  
Shipped Date
Jan 22, 2014  
Inserted
Jul 02, 2014