flash(); ?>

Clone

Target
CPX_06555_06559  
Clone Suffix
102
Sequence Comments
CPX_06555_06559.1-516.F..pMCSG68  
Experiment Start Date
Feb 01, 2015  
Experiment End Date
Feb 03, 2015  
Person
Robert Jedrzejczak  
Lab
Argonne National Laboratory  
Protocol ID
standard cloning_ANL  
Status
success  
Vector
pMCSG68  
Sequence Start
 
Sequence End
 
Reference Sequence Used
 
PCR Forward Primer
TACTTCCAATCCAATGCCGTGCACGCCGACCTCGCA  
PCR Backward Primer
TTATCCACTTCCAATGTTACGCTGAGGTTCGGCCAGTAG  
Shipped To Lab
ANL  
Shipped Date
Jun 02, 2015  
Inserted
Aug 16, 2016